Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES15_c18398_75

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES15_c18398_75
Species
Avena sativa
Probe
GMI_ES15_c18398_75
DNA
tcgaagcataccaaaaatgctgccatatccgcagctccatcatcttgacg
cccgttcttcattttatctgcactgagaatccgcaatgagaagcttatag
gWtcttcacaaatggtggtacatcctcccttggcccctcgagtgatcgat
aacatgtataatatgtccacaaccgt
BLAST
BLAST Search