Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES15_c4231_158

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES15_c4231_158
Probe
GMI_ES15_c4231_158
DNA
acatgctggacaagcaaatcggactactgccaggtgtaatgtttgacaca
actcctattgRcactcactttggagatgtcagctccgacgttcctgcaaa
ctcaaacttcaggaagggtag
BLAST
BLAST Search