Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES15_c5451_344

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES15_c5451_344
Probe
GMI_ES15_c5451_344
DNA
tacggtctatgaggacatcttcacggccaaattcatctacacgtggcatg
attggatagaRtcgaggacagttataacagaaactatattagcccttgct
aatcatgtggagctggctggg
BLAST
BLAST Search