Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES17_c2651_991

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES17_c2651_991
Probe
GMI_ES17_c2651_991
DNA
tagcccgcagggcttgaatctgtctttggcgtgtactctgaagtattgtg
tacccagaagagttacagcgagatgagcctggcagttatgacgatcagct
Saaataccaaaaagttgtaactctgatatatgacaacttgatctcagatt
ttagaagtttccgtttccttagttacaaaaaaaaaaaagttaattaatac
g
BLAST
BLAST Search