Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES17_c6857_627

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES17_c6857_627
Probe
GMI_ES17_c6857_627
DNA
gggtgctgctccggcgattgaggctctggtgctggggcatccgatggagg
tggggtctgcRgcttcggcgctggctttggtttagtcatgatcgctttgc
agaatctgtcaagttcttcgg
BLAST
BLAST Search