Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES17_c9169_589

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES17_c9169_589
Species
Avena sativa
Probe
GMI_ES17_c9169_589
DNA
actgcccaaatatccccacatacatattattaatctgtaattttctgaag
atataactataacagtgtatcctctgtgacagttaagttccataaaatgg
cYagacacgtttattctgtgataatttttgctgtgtatagtatagcatta
agaagccttcatatcatcgagtccaacacttgccaggaattcatgattct
cc
BLAST
BLAST Search