Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES17_c9754_347

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES17_c9754_347
Probe
GMI_ES17_c9754_347
DNA
tccttttaactcttgcaatagctcctagctgcattcagctgccctatcaa
gtcttggatggtggaagacgcctccgttatcttgtttcgcaaattctgct
Yctcttggtctcgacgcttcatctcttctgcataggcgtccaccaacgct
tcttgctccttttttgctgtttcaagcttcgcctctagattctccattgt
tt
BLAST
BLAST Search