Query (optional)   in Class  

GrainGenes Sequence Report: GMI_GBS_75703

[Submit comment/correction]

Sequence
GMI_GBS_75703
Probe
GMI_GBS_75703
DNA
tgcaggacctcccgccgagcgcctccaggattccatcgagaagtgcatcg
ccgacaccaagaaK

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.