Query (optional)   in Class  

GrainGenes Sequence Report: IAAV2607

[Submit comment/correction]

Sequence
IAAV2607
Contig
2BL_8005433
Species
Triticum aestivum
Probe
IAAV2607
DNA Homology
2BL_8005433Best IWGSC match1584e-36URGI_BestIWGSC_N
BLAST, e-value
4e-362BL_8005433Best IWGSC match
DNA
ggattttgccggtcccagtccttgaacataatcacactagccaagatggt
taaagatgtgaacattgtataatatatgggagatacaactgctgtRttaa
atgtgtcaagggccttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.