Query (optional)   in Class  

GrainGenes Sequence Report: IAAV3211

[Submit comment/correction]

Sequence
IAAV3211
Contig
5DL_4511472
Probe
IAAV3211
DNA Homology
5DL_4511472Best IWGSC match1613e-37URGI_BestIWGSC_N
BLAST, e-value
3e-375DL_4511472Best IWGSC match
DNA
gacctttcgttttgatatctttaggtactagaggatgctgaggatactta
tcttccagatacaacatgatagcgagagaatcagatagaacaaagtcccc
Rtctaccaatgctggtatgtatttgatcgggtttattttttcatagtctg
gatctgtccgaggattgactgccttatactcgtagtccacacctttgaga
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.