Query (optional)   in Class  

GrainGenes Sequence Report: IAAV3268

[Submit comment/correction]

Sequence
IAAV3268
Contig
7BL_6688671
Probe
IAAV3268
DNA Homology
7BL_6688671Best IWGSC match3070URGI_BestIWGSC_N
BLAST, e-value
07BL_6688671Best IWGSC match
DNA
agtatggtgaagcacatgccagtttctgggctgaaaaaattgtacagatt
tagatgcaggcaagttcWggcattcctgtaggtaagagccacaaaatttt
agttgcattgctaaggcatgttttgattgatgtatttgctgtcaaattta
gtatgttcggctgtaatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.