Query (optional)   in Class  

GrainGenes Sequence Report: IAAV6972

[Submit comment/correction]

Sequence
IAAV6972
Contig
2AL_6330390
Probe
IAAV6972
DNA Homology
2AL_6330390Best IWGSC match2980URGI_BestIWGSC_N
BLAST, e-value
02AL_6330390Best IWGSC match
DNA
tagtttgaatgaggaattggaagtacatcagaacaagctgaatgaattac
agatgacacttgctgctgcagtagcagaaaagcagggggtgtcggaagag
Rttcattcantgcgaaaaacactcaatggcatgattcaacgcaaggaaga
gctcgaaagccaggtatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.