Query (optional)   in Class  

GrainGenes Sequence Report: IAAV7872

[Submit comment/correction]

Sequence
IAAV7872
Contig
3B_10694442
Probe
IAAV7872
DNA Homology
3B_10694442Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
03B_10694442Best IWGSC match
DNA
tcaccagatccttacttgtccctatctgtaggttactgacagcacctttc
tttgaaactccataagggaacctgataaattctgtatcacaggacttgtg
Rtctgtttccatagttcgctcagacttgagaaatgcgcaatcttgtagca
gaagctggttaagctccacagacgcagccagggatggcaagcattcgata
g
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.