Query (optional)   in Class  

GrainGenes Sequence Report: IACX2961

[Submit comment/correction]

Sequence
IACX2961
Contig
1DL_2238955
Probe
IACX2961
DNA Homology
1DL_2238955Best IWGSC match1950URGI_BestIWGSC_N
BLAST, e-value
01DL_2238955Best IWGSC match
DNA
ccagatgctgtactgcacgagcttgagctggagcgcggacggaagcaccc
tctacaccggRtacaccgacggaaccatcagggtcttcaagatccaagcc
gggttcgctggttacgccta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.