Query (optional)   in Class  

GrainGenes Sequence Report: IACX568

[Submit comment/correction]

Sequence
IACX568
Contig
5BS_2269508
Species
Triticum aestivum
Probe
IACX568
DNA
gaatatattacgaaaaactaacacctaacaacatcagtaaacatgctgcc
tcttaaaaaaRagtaaacatgctgcctcaccccacgtttctcaaacgtct
cggagagagacttgatcactc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.