Query (optional)   in Class  

GrainGenes Sequence Report: IACX5891

[Submit comment/correction]

Sequence
IACX5891
Contig
4BL_7012439
Probe
IACX5891
DNA Homology
4BL_7012439Best IWGSC match1950URGI_BestIWGSC_N
BLAST, e-value
04BL_7012439Best IWGSC match
DNA
tgctggacaagagagatatgctgccttggcacctctttactacagaggag
ctgctgctgcRgttgttgtctatgacataactagtccagaatcattcaag
aaagcacaatattgggtgaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.