Query (optional)   in Class  

GrainGenes Sequence Report: JD_c11606_1380

[Submit comment/correction]

Sequence
JD_c11606_1380
Contig
4BL_7026015
Species
Triticum aestivum
Probe
JD_c11606_1380
DNA
cttgtaattaagagtttcaccaaaatgttgtgtggtcaagtgactacact
Rctggaacgtggcttcgccactgcccacaagctcaagtaagctcaatgaa
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.