Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c5227_133

[Submit comment/correction]

Sequence
Jagger_c5227_133
Contig
6AS_4394696
Probe
Jagger_c5227_133
DNA Homology
6AS_4394696Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AS_4394696Best IWGSC match
DNA
gaccgaaaagcttaatcaatgtcttgagacctttctcaggtgtacggttc
Rtgcttcgccgaccaaatggtctcaatggttgccttcggctgaacattgg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.