Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c10508_755

[Submit comment/correction]

Sequence
Kukri_c10508_755
Contig
5AL_1340836
Probe
Kukri_c10508_755
DNA Homology
5AL_1340836Best IWGSC match1712e-40URGI_BestIWGSC_N
BLAST, e-value
2e-405AL_1340836Best IWGSC match
DNA
cttgtcccctttgatgaacgcggacaaaaatcccccgaaacatagagctc
Rtcattagctattgggtaaccaaggtgttttagatgcacccgtatctggt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.