Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c16034_113

[Submit comment/correction]

Sequence
Kukri_c16034_113
Contig
7DL_3334518
Probe
Kukri_c16034_113
DNA Homology
7DL_3334518Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-417DL_3334518Best IWGSC match
DNA
tcaccgtattttctcacaccgggcgcacgcctcgtctgaatgaactcagt
Rtactgcgggttcttgacctcgaaggctgtcaaggtccactgtgccttga
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.