Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c20771_697

[Submit comment/correction]

Sequence
Kukri_c20771_697
Contig
4AL_7061368
Probe
Kukri_c20771_697
DNA Homology
4AL_7061368Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444AL_7061368Best IWGSC match
DNA
ctgtccctgtccacctgctgcctctctgtgtcgctaggccctgtcataac
Rttcatgacttcgcccgacatgaatgtgatcctcaagggaggagtcgcat
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.