Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c21276_816

[Submit comment/correction]

Sequence
Kukri_c21276_816
Contig
1BL_3874709
Probe
Kukri_c21276_816
DNA Homology
1BL_3874709Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441BL_3874709Best IWGSC match
DNA
ttcacgctcactcttcttacccttcttttctgcagggctggcatcatcca
Mctccttgtccaaagcacgcttcttatccttgcccttctttggggtcttc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.