Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c22152_944

[Submit comment/correction]

Sequence
Kukri_c22152_944
Contig
2AS_5265661
Species
Triticum aestivum
Probe
Kukri_c22152_944
DNA
atgaggatgaggatagcctagacgaggaggttcagaggcccaggactcgc
Mggaggttcgtgaggtcaaggtcggaggagcggcgctgacgcgtgggcga
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.