Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c22338_70

[Submit comment/correction]

Sequence
Kukri_c22338_70
Contig
5BL_10791567
Species
Triticum aestivum
Probe
Kukri_c22338_70
DNA
GATTCCAATGTCGTCGCCGTTCAATCCCAACAATCCCATGTTCAGGGTTC
RGAGTTCGCCTAACCTCCCGAATGGCGGTGCTGCTGGTAGCCCGTTTAAA
C
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.