Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c2408_784

[Submit comment/correction]

Sequence
Kukri_c2408_784
Contig
1DS_1899543
Probe
Kukri_c2408_784
DNA Homology
1DS_1899543Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-411DS_1899543Best IWGSC match
DNA
aataaaccacgagaagattgtgcttgttccttcggaatgctttcatctcc
Rttggcttgcttaacagtgactgcgccgtttggtattacattattacttt
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.