Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c26488_139

[Submit comment/correction]

Sequence
Kukri_c26488_139
Contig
7BS_3160042
Probe
Kukri_c26488_139
DNA Homology
7BS_3160042Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447BS_3160042Best IWGSC match
DNA
ttgtttacttggtttgaactctgaatgatatgttgttatcctgcacgcat
Rcctgatgagttggtgctgctggtattttgaggaggcaagttgtggtttt
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.