Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c29420_310

[Submit comment/correction]

Sequence
Kukri_c29420_310
Contig
5AS_1528124
Species
Triticum aestivum
Probe
Kukri_c29420_310
DNA
ggtggaaagcgtatagttcctgcagcacgtatgcccgacgggagcgcatc
Ractaaccgtggaaatgctcagtctggtggcaatcccaaccaaaatgggg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.