Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c3009_1702

[Submit comment/correction]

Sequence
Kukri_c3009_1702
Contig
6AS_4354844
Probe
Kukri_c3009_1702
DNA Homology
6AS_4354844Best IWGSC match1281e-27URGI_BestIWGSC_N
BLAST, e-value
1e-276AS_4354844Best IWGSC match
DNA
tcggatgtatttgaaggcacggtacctgcgccagttgcatgagattgcac
Rttcagagaagtttgtccatgatgagaacctggaagctcattttgtaatt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.