Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c33665_418

[Submit comment/correction]

Sequence
Kukri_c33665_418
Contig
3B_10770993
Probe
Kukri_c33665_418
DNA Homology
3B_10770993Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-443B_10770993Best IWGSC match
DNA
tgtggggaatcatctatagtgttaccattggagctgagcgcattggagtc
Rttggcggtggccatgacaccctcacttccaccgtcagagtcctgtcagc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.