Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c3734_400

[Submit comment/correction]

Sequence
Kukri_c3734_400
Contig
7BS_3113433
Probe
Kukri_c3734_400
DNA Homology
7BS_3113433Best IWGSC match1412e-31URGI_BestIWGSC_N
BLAST, e-value
2e-317BS_3113433Best IWGSC match
DNA
ccttcttgtactcaggcacatccacctcataggaattcaactggttgtca
Ratgcatggatggtaggatttgcatcttcaggaagatcaacgggagaagg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.