Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c37742_69

[Submit comment/correction]

Sequence
Kukri_c37742_69
Contig
2BL_8077848
Probe
Kukri_c37742_69
DNA Homology
2BL_8077848Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BL_8077848Best IWGSC match
DNA
cacttgtgaaaccaggatacttgcggtaaatcaaagtcatgagtggcttc
Mcaacagcactctttgcagctctatcaaagaacataaattctgcctcagc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.