Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c41556_619

[Submit comment/correction]

Sequence
Kukri_c41556_619
Contig
2DS_5390773
Probe
Kukri_c41556_619
DNA Homology
2DS_5390773Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442DS_5390773Best IWGSC match
DNA
aggttgaaatcgttcttgggcaagtcattcaggagaaactgcagctccac
Rccgtgttgttcttcgtttgtgttctggttgtagtcagagatcatgccgg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.