Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c42622_369

[Submit comment/correction]

Sequence
Kukri_c42622_369
Contig
4AL_7168216
Probe
Kukri_c42622_369
DNA Homology
4AL_7168216Best IWGSC match1673e-39URGI_BestIWGSC_N
BLAST, e-value
3e-394AL_7168216Best IWGSC match
DNA
acaatgacgtcgcgggtgtacccgatggaggcctatcaggaggcaaaagt
Rtacttgttcaacaatgccaccggtgccagcgtcacggcggaaaggatcg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.