Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c46542_1015

[Submit comment/correction]

Sequence
Kukri_c46542_1015
Contig
2DS_5389018
Probe
Kukri_c46542_1015
DNA Homology
2DS_5389018Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-422DS_5389018Best IWGSC match
DNA
gggtaaagtaaacagctacagtacaaagaaggtaccaactcagatgcaac
Rgtagctcccgctggagaaggtgtggccaacttcattaaattgggcagtg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.