Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c46904_401

[Submit comment/correction]

Sequence
Kukri_c46904_401
Contig
5DL_4605525
Species
Triticum aestivum
Probe
Kukri_c46904_401
DNA
tggccccatcacaatctactccaaagtgatcatgctgcaacactgcatgc
Rctgatcacatggccttgtccctggccaactcttcagagtgacaactact
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.