Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c48951_419

[Submit comment/correction]

Sequence
Kukri_c48951_419
Contig
1AS_1591062
Probe
Kukri_c48951_419
DNA Homology
1AS_1591062Best IWGSC match1803.9937e-43URGI_BestIWGSC_N
BLAST, e-value
3.9937e-431AS_1591062Best IWGSC match
DNA
tgaacagcaccataatgttgcgtcaatgctttatgagggtcaagaaatgc
Rtggaccagtgtctttgttaaccggatttggagattgtggtacayatgac
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.