Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c52953_562

[Submit comment/correction]

Sequence
Kukri_c52953_562
Contig
6BS_96655
Probe
Kukri_c52953_562
DNA Homology
6BS_96655Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-416BS_96655Best IWGSC match
DNA
cctgacggaccgactgtgccctcgccacaaatgcctggcagacccccctc
Rcacagtcgttccaacagcaactcgtccgtgcggcttaccggcttgacgg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.