Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c5325_2120

[Submit comment/correction]

Sequence
Kukri_c5325_2120
Contig
6AL_5820503
Probe
Kukri_c5325_2120
DNA Homology
6AL_5820503Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AL_5820503Best IWGSC match
DNA
ctgatgctgacttcattctcacttacactgatgaggatggggatgttgtt
Mtgctggatgatgacgaggacttgcatgatgcagctatccatcagaaatt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.