Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c5417_177

[Submit comment/correction]

Sequence
Kukri_c5417_177
Contig
5DL_4498111
Probe
Kukri_c5417_177
DNA Homology
5DL_4498111Best IWGSC match1321e-28URGI_BestIWGSC_N
BLAST, e-value
1e-285DL_4498111Best IWGSC match
DNA
tgttgaggacggcggcatcatatgtcaattctcgcttacatgcagtcaaa
Rcccagaccctggtggttgctagtggaaatgatgaactgctgccaagccg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.