Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c59535_427

[Submit comment/correction]

Sequence
Kukri_c59535_427
Contig
1DL_303732
Probe
Kukri_c59535_427
DNA Homology
1DL_303732Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DL_303732Best IWGSC match
DNA
gtaaaacccttgttgatatccaatgcgatgccatggggatccaaactccc
Rctaccatcattcgagcttgaggtgagaaaacccgcatcaccatgatcca
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.