Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c6626_57

[Submit comment/correction]

Sequence
Kukri_c6626_57
Contig
2BS_5247476
Probe
Kukri_c6626_57
DNA Homology
2BS_5247476Best IWGSC match1673e-39URGI_BestIWGSC_N
BLAST, e-value
3e-392BS_5247476Best IWGSC match
DNA
agctcggctagctggccagtggagacgaggttggcctcaagccctgggac
Rtacagaacatctctcagggtcatgttcttggtgttcaccgaaccgctgc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.