Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c7087_896

[Submit comment/correction]

Sequence
Kukri_c7087_896
Contig
3AL_4300148
Probe
Kukri_c7087_896
DNA Homology
3AL_4300148Best IWGSC match1673e-39URGI_BestIWGSC_N
BLAST, e-value
3e-393AL_4300148Best IWGSC match
DNA
gctcgagcaagacgactccaaagctccatacgttgctcttgggagtcagt
Rcccctttctccaaggtttcctctgagaggtttgtagcagtcacagatgc
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.