Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c75091_154

[Submit comment/correction]

Sequence
Kukri_c75091_154
Contig
5AL_2752914
Probe
Kukri_c75091_154
DNA Homology
5AL_2752914Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445AL_2752914Best IWGSC match
DNA
cgcagcccggtaaagcccaactactaacaacaacagacagctctcatccc
Rtgctattcaatcaaagattggatcgagcgcatgactgcgcctgggcatc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.