Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c91279_125

[Submit comment/correction]

Sequence
Kukri_c91279_125
Contig
5BL_10916533
Probe
Kukri_c91279_125
DNA Homology
5BL_10916533Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_10916533Best IWGSC match
DNA
ccactacgcccaagcgcctcctttgcaacttgtctatgtgcaagcccaac
Rccctgtgccagaacatgttacagaccctgcctgttcctctgatcccaac
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.