Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_c9804_462

[Submit comment/correction]

Sequence
Kukri_c9804_462
Contig
5DL_4511472
Probe
Kukri_c9804_462
DNA Homology
5DL_4511472Best IWGSC match1611e-37URGI_BestIWGSC_N
BLAST, e-value
1e-375DL_4511472Best IWGSC match
DNA
tcttccagatacaacatgatagcgagagaatcagatagaacaaagtcccc
Rtctaccaatgctggtatgtatttgatcgggtttattttttcatagtctg
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.