Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_rep_c103463_68

[Submit comment/correction]

Sequence
Kukri_rep_c103463_68
Contig
4BS_4921157
Probe
Kukri_rep_c103463_68
DNA Homology
4BS_4921157Best IWGSC match1764.99983e-42URGI_BestIWGSC_N
BLAST, e-value
4.99983e-424BS_4921157Best IWGSC match
DNA
ttcaatgccctgcgatgtgcaaaagtacgtattggagggcatggcacctg
Rgctctatgggatgcacgccaatcccaactgcataaacaaatatggatac
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.