Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_rep_c115986_62

[Submit comment/correction]

Sequence
Kukri_rep_c115986_62
Contig
5AL_2761758
Probe
Kukri_rep_c115986_62
DNA Homology
5AL_2761758Best IWGSC match1595e-37URGI_BestIWGSC_N
BLAST, e-value
5e-375AL_2761758Best IWGSC match
DNA
gaacctaacctccagataagcaagagatatgatgctcgataactgcgctc
Rcttcgatatagaattgtgtggctaatccctaatcctgctggctcatgag
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.