Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_rep_c90581_382

[Submit comment/correction]

Sequence
Kukri_rep_c90581_382
Contig
2BS_5157298
Probe
Kukri_rep_c90581_382
DNA Homology
2BS_5157298Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BS_5157298Best IWGSC match
DNA
ctcatgtcccttgcttctctgcgtattggctggttgtcaaggcgaagcgc
Rcttacttcccaaggatgttcccacaggcttacgtgaggacaagttagag
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.