Query (optional)   in Class  

GrainGenes Sequence Report: Kukri_rep_c95804_119

[Submit comment/correction]

Sequence
Kukri_rep_c95804_119
Contig
5AS_1478618
Probe
Kukri_rep_c95804_119
DNA Homology
5AS_1478618Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445AS_1478618Best IWGSC match
DNA
gtgttattcctgttgttactcgaaagatagattgcattacataatgtgct
Racagctgtagtgatgctgatttgatggacaaggactgtccgtccgtctg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.