Query (optional)   in Class  

GrainGenes Sequence Report: L39777

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L39777
Subsequence
L39777_1.cds57566
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein P50698
DB Remark
Locus Source: Avena sativa (oat)
Keyword
pathogenesis-related protein
thaumatin-like pathogenesis-related protein
thaumatin-like protein
Species
Avena sativa
Tissue
leaf, seedling
Data Source
genbankRelease 141, Apr 15 2004
Title
Avena sativa thaumatin-like pathogenesis-related protein (rastl-4) mRNA, complete cds.
Strain
Rodney (Pg-2)/Pga-1H
Clone
pCRL104
Probe
rast1-4
Gene
Rast1-4 (Avena)
Gene Class
Pathogenesis-related protein
Gene Product
thaumatin-like pathogenesis-related protein
Remark
DB_xref: taxon:4498
Feature: polyA_site: gene = 'rastl-4'
Feature: source: mol_type = 'mRNA'
Gene: rastl-4
Reference
ReferenceLin K-C et al. (1996) Isolation and expression of a host response gene family encoding thaumatin-like proteins in incompatible oat-stem rust fungus interactions Molecular Plant-Microbe Interactions 9:511-522.
EMBL Feature
mat_peptide120563putativeLocation: 120..563
[ Show all 7 ]
DNA
cccatacctagcaagctcgaacaaagcgaaactaaccagctagctagctt
gcagcaatggcgacctcctccacggtgctttttctcctccttgccgtttt
cgccgccagtgccagcgcggccaccttcaccatcaccaacaactgcggct
acacggtgtggccggcggccatcccagtgggcggcggccagcagcttgac
cagggccagacgtggaccctcaacgtgcctgccggcaccaactccggcag
gatatggggccgtaccgggtgctccttcaacggcggaagcgggagctgcc
agaccggcgactgcgccggcgcgctgtcctgcaccttatccgggcagccg
gcgacgctggccgagttcagcatcggcggcgagcacgactactacgacat
ttcggtgatcgacgtctacaacctcgccatggacttctcctgcagcaccg
gcgatgcgctccagtgcagggattccagctgccccgatgcctatcaccaa
cccgacgacccaaaaacccactcatgcaacaccaacagcaactaccagat
caccttctgcccatgaaaccctacgtcgcgcagccaataaatcgaccgta
taaatagtatgatacatcatagtgctatcatctgtattctagccgttgtg
catgtgcatgtgctgagtgctatcatcatagtgctatcatctgtattcta
tcataaagttaaataaataaatcgagggtgcatgtgctgagtgc
BLAST
BLAST Search